Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia

Cover Page

Abstract

Background. Recently, a new multicomponent RNA-containing virus was described and called as Jingmen tick virus (JMTV) supposedly belonging to flaviviruses. A virus contains of four viral particles and JMTV was firstly isolated from ticks in China.

Aims. Detection viral RNA specific for JMTV complex, sequencing genome fragments and taxonomy identification novel virus from JMTV complex in patients with Crimean-Congo hemorrhagic fever (CCHF) from southern European part of Russia.

Methods. Panel of 20 randomly selected sera from patients with confirmed Crimean-Congo hemorrhagic fever was collected in 2016 and was used for detection JMTV and CCHF viral RNA by PCR with experimental primers. Subsequent sequencing of isolated fragments of viral genomes was used for identification JMTV and CCHF virus genetic materials and phylogenetic analyses.

Results. The RNA of the CCHF virus and JMTV were detected in sera of four patients. Sequencing of the PCR fragments from S segment CCHF virus were identifying these isolates as members of Europa 1 clade. The nucleotide sequences of segment 2 (GP glycoprotein) of novel JMTV isolates clustered together by phylogenetic analysis. The level nucleotide identity for discovered JMTV isolates was only about 81−82% with comparison to the previously described European variants (Kosovo) of JMTV.

Conclusions. The results allow us to conclude that in CCHF patients the RNA of the CCHF virus and RNA of the novel multicomponent JMTV flavivirus were detected in serum.

Full Text

Обоснование

В различных видах клещей, собранных в китайских провинциях Hubei и Zhejiang, был впервые обнаружен новый многокомпонентный РНК-содержащий вирус, получивший название Jingmen tick virus (JMTV) [1]. Наиболее часто JMTV обнаруживался в клещах Rhipicephalus microplus, собранных с собак и коров. Геном JMTV разделен на 4 сегмента, размер которых колеблется от 2751 до 3072 нуклеотидов. Общий размер генома составляет 11 401 нуклеотид. Каждый РНК-сегмент упакован в отдельную вирусную частицу, сегмент 1 кодирует белок, схожий с NS5 белком флавивирусов, а сегмент 3 — NS2b-NS3-подобные белки флавивирусов. Сегменты 2 и 4 кодируют структурные вирусные белки VP1, VP2 и VP3. Схожесть неструктурных белков с известными неструктурными белками флавивирусов, а именно с РНК-зависимой РНК полимеразой (NS5) и двухкомпонентной сериновой протеазой (NS2b-NS3), позволила отнести JMTV к неклассифицированным сегментированным флавивирусам. Структурные белки не имели известных аналогов среди известных вирусных белков. Для успешной репликации вируса необходимо участие всех 4 вирусных частиц, содержащих соответствующие сегменты генома JMTV.

В Бразилии из клещей R. microplus был выделен вирус Mogiana tick virus (MGTV) [2]. Секвенирование полного генома MGTV позволило отнести его к вирусу JMTV [3]. Пятикомпонентные комариные вирусы Guaico Culex virus со схожей стратегией реализации генетической информации и с последовательностями, гомологичными с неструктурными белками флавивирусов, были также обнаружены в ряде стран Центральной и Южной Америки [4]. Позднее сообщалось об обнаружении вируса JMTV в Уганде, Гвинее, Европе и в граничащих с Россией провинциях на севере Китая [5, 6]. Обнаружение генетического материала вируса JMTV в различных видах комаров, клещей, млекопитающих, включая приматов, позволило высказать предположение, что многокомпонентные флавивирусы способны преодолевать видовой барьер и инфицировать млекопитающих. Обнаружение MGTV в слюнных железах клещей R. microplus, как у личинок, так и у взрослых особей, свидетельствовало о том, что клещи R. microplus могут служить вектором для передачи MGTV различным животным, включая человека [2, 7]. Недавно было выявлено 86 случаев нового лихорадочного заболевания человека после укусов таежного клеща на севере Китая, вызванного многокомпонентным вирусом Alongshan группы Jingmen tick virus [8]. Также РНК JMTV была впервые обнаружена в образцах сыворотки крови трех пациентов с Крымской-Конго геморрагической лихорадкой (ККГЛ) в Косово [5]. Это позволило предположить, что вирусы JMTV и Alongshan могут успешно реплицироваться в тканях человека и участвовать в патогенезе развития различных клещевых вирусных инфекций после укуса клеща.

ККГЛ является одной из наиболее распространенных и важных, с медицинской точки зрения, клещевых вирусных инфекций с высоким уровнем летальности [9]. Вирус ККГЛ обычно передается человеку через укус клещей рода Hyalomma. Косово считается одной из немногих европейских стран, эндемичных по ККГЛ. В этой стране с середины 90-х годов XX века случаи заболевания людей ККГЛ регистрируются ежегодно со средним уровнем летальности ~25% [10−12].

Цель исследования ― обнаружение РНК вируса JMTV в сыворотке крови людей, больных ККГЛ, на юге России с последующим филогенетическим анализом фрагментов вирусного генома.

Методы

Дизайн исследования

Наблюдательное одноцентровое выборочное неконтролируемое одномоментное исследование.

Продолжительность исследования

Образцы были собраны в течение мая-июля 2016 г.

Описание медицинского вмешательства

Однократно проводился забор 1 мл венозной крови. Сыворотка крови в количестве 200 мкл хранилась при температуре -30°С. В дальнейшем сыворотка крови транспортировалась с соблюдением холодовой цепи.

Критерии соответствия

В исследование были включены сыворотки крови от людей из медицинских учреждений Ростовской области с лабораторно подтвержденным диагнозом ККГЛ. Сыворотки крови были переданы в Ставропольский противочумный институт Роспотребнадзора, где было лабораторно получено подтверждение наличия в образцах РНК вируса ККГЛ.

Образцы сывороток, содержащие РНК вируса ККГЛ, были переданы в ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора, где были проведены исследования на наличие в образцах многокомпонентных РНК-содержащих вирусов.

Исходы исследования

В результате проведенных исследований в сыворотках крови, содержащих РНК вируса ККГЛ, в четырех образцах из двадцати была обнаружена РНК JMTV вируса, изолятам которой было присвоено имя Manych по месту обнаружения.

Методы регистрации исходов

Для проведения генетической диагностики суммарную РНК экстрагировали с помощью Trizol реагента (Life Technologies Corp/ThermoFisher Scientific, США) согласно инструкции производителя. Синтез кДНК проводили с помощью набора «Реверта-L» (ИнтерЛабСервис, Россия). Наличие РНК вируса ККГЛ в сыворотках подтверждали методом полимеразной цепной реакции (ПЦР) с использованием набора реагентов для выявления РНК вируса ККГЛ «АмплиСенс CCHFV-FL» (ЦНИИ эпидемиологии Роспотребнадзора, Россия). Для секвенирования S-сегмента вируса ККГЛ длиной 1450 пар нуклеотидов были использованы праймеры, согласно Е. Вакаловой и соавт. [13], по программе амплификации: 95°C 5 сек, 50°С 10 сек, 72°С 30 сек, 40 циклов.

Обнаружение генетического материала JMTV проводилось методом ПЦР (БиоМастер LR HS-ПЦР, ООО «Биолабмикс», Россия) с использованием специфических праймеров к сегменту 2 (ген гликопротеина GP) вируса JMTV. Были использованы следующие олигонуклеотиды: F327 (CTTGCTACGTCGGGCTCATG) и R540 (CGTCCTCGCAGAGTCGCACA), амплификация фрагмента 213 пар нуклеотидов проводилась по следующей программе: 95°C 5 сек, 55°С 10 сек, 72°С 30 сек, 40 циклов.

Продукты ПЦР визуализировались путем электрофореза в 2% агарозном геле, окрашенном бромистым этидием, с использованием системы для фотодокументации гелей (Universal Hood II, Bio-Rad, США). Полученные фрагменты ДНК очищали с использованием набора для элюции ДНК из агарозного геля (БиоСилика, Россия) и секвенировали на приборе ABI-Prism 3500 с использованием наборов реагентов BigDye Terminator v3.1 (ThermoFisher Scientific, США).

Этическая экспертиза

Забор крови у пациентов для диагностики возбудителей инфекционных заболеваний проводился в медицинских учреждениях Ростовской области в соответствии с их информированными согласиями, оформленными в медицинских учреждениях. Исследования в Ставропольском противочумном институте Роспотребнадзора и в ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора проводились по прямому распоряжению Правительства РФ № 88 от 17.03.2008 и в соответствии с Приказом Роспотребнадзора № 1116 от 01.12.2017.

Методы анализа данных

Для анализа нуклеотидных последовательностей была использована программа Lasergene 9 (DNASTAR Inc. Madison, WI, США). Филогенетический анализ проводили с использованием статистического метода наибольшего правдоподобия (Maximum likelihood), дерево было построено по методу ближайших соседей (Neighbor-joining) с использованием двухпараметрической модели Кимуры-2 (Kimura-2 parameter с Bootstrap), поддержкой 1000, с помощью программы Tree Explorer MEGA 7 [14]. Для сравнения были использованы нуклеотидные последовательности различных штаммов вирусов ККГЛ и JMTV, взятые из базы данных GenBank.

Результаты

Объекты (участники) исследования

Образцы обезличенных сывороток крови от пациентов, которые были госпитализированы в разгар заболевания. Диагноз ККГЛ у пациентов был подтвержден методом ПЦР с обратной транскрипцией.

Основные результаты исследования

Методом ПЦР в реальном времени с использованием коммерческого набора реагентов, а также c использованием экспериментальных праймеров к S-сегменту генома вируса ККГЛ нами было обнаружено наличие генетического материала вируса ККГЛ в сыворотках от пациентов из Ростовской области. Фрагменты комплементарных ДНК были секвенированы, и было подтверждено наличие в этих пробах генетического материала вируса ККГЛ. Анализ фрагмента нуклеотидной последовательности S-сегмента вируса ККГЛ длиной 1450 пар оснований показал, что все последовательности вируса кластеризуются в группе, относящейся к генотипу Европа 1 (рис. 1).

 

Рис. 1. Филогенетический анализ вируса ККГЛ на основе S-сегмента (1450 пар нуклеотидов). Анализ проведен методом Neighbor-joining с использованием двухпараметрической модели Кимуры. Значимость построенного дерева была оценена с помощью бутстреп-анализа с 1000 повторами.

 

Дополнительно в четырех образцах был обнаружен генетический материал JMTV. Проведенный анализ с другими последовательностями MGTV и JMTV выявил, что нуклеотидные последовательности образцов из Ростова были ближе к последовательностям JMTV вируса, циркулирующего в Китае и Бразилии (уровень гомологии 94,4%) и к последовательностям Kindia tick virus, выделенным нами ранее из клещей Rhipicephalus geigyi в районе г. Киндия, Гвинея (GenBank, MK673133−MK673136). Последовательности образцов JMTV от больных ККГЛ, ранее обнаруженные в Европе (Косово), имели уровень гомологии 81,8−82,2% с ростовскими изолятами. Анализ полученных нами нуклеотидных последовательностей JMTV показал, что во фрагменте гена GP сегмента 2, состоящем из 173 нуклеотидов, при сравнении с изолятом JMTV AYV61026, выделенным в 2016 г. в Бразилии, было найдено 12 нуклеотидных замен. В четырех случаях нуклеотидные замены приводили к аминокислотным заменам.

На рис. 2 представлен филогенетический анализ нуклеотидных последовательностей изолятов JMTV Rostov 16 Russia 2016, Rostov 24 Russia 2016, Rostov 27 Russia 2016 и Rostov 72 Russia 2016. Все ростовские изоляты JMTV кластеризовались вместе и при сравнении с известными последовательностями вирусов JMTV формировали отдельную филогенетическую ветвь. Уровень генетических отличий выделенных нами изолятов JMTV от вариантов, ранее обнаруженных в Бразилии, Китае, Косово и Африке, показывает выраженное генетическое разнообразие этой группы вирусов [15]. При этом российские изоляты JMTV, выделенные от человека, существенно отличаются от изолятов JMTV, выделенных от человека в Европе (Косово), и образуют отдельную филогенетическую группу.

 

Рис. 2. Филогенетическое дерево группы JMTV, построенное на основе известных нуклеотидных последовательностей. Анализ проведен методом Neighbor-joining с использованием двухпараметрической модели Кимуры. Приведены оригинальные названия штаммов, депонированных в GenBank. Последовательность вируса Alongshan (MH158416) использовалась как внешняя группа. Значимость построенного дерева была оценена с помощью бутстреп-анализа с 1000 повторами.

 

Нуклеотидные последовательности идентифицированных РНК изолятов Rostov 16 Russia 2016, Rostov 24 Russia 2016, Rostov 27 Russia 2016 и Rostov 72 Russia 2016 JMTV вируса и изолятов Rostov 1-16 Russia 2016, Rostov 3-24 Russia 2016, Rostov 4-27 Russia 2016 и Rostov 2-72 Russia 2016 вируса ККГЛ были депонированы в GenBank, номера депонированных последовательностей ― MN218697, MN218698 и MN218693−MN218696 соответственно.

Обсуждение

Резюме основного результата исследования

В сыворотках крови пациентов с клиническим диагнозом ККГЛ выявлено одновременное наличие РНК вируса ККГЛ и РНК многокомпонентного JMTV. Полученные результаты позволили заключить, что на юге России у людей с клиническими проявлениями заболевания, характерными для ККГЛ, встречается вирусная инфекция, ассоциированная также с многокомпонентным JMTV.

Обсуждение основного результата исследования

JMTV был впервые обнаружен в слюнных железах клещей R. microplus, как у личинок, так и у взрослых особей [1, 2], что свидетельствовало о том, что клещи могут служить вектором для передачи JMTV и MGTV различным теплокровным животным. Обнаружение изолята RC27 JMTV в крови мартышек (род Piliocolobus) в Уганде подтвердило это предположение [4]. В 2018 г. в образцах сывороток, собранных от пациентов с ККГЛ в Косово, был обнаружен генетический материал JMTV, и были определены нуклеотидные последовательности всех 4 сегментов многокомпонентного флавивируса [5]. По всей вероятности, JMTV был передан человеку через укус клеща рода Hyalomma, который является основным вектором, обеспечивающим инфицирование человека вирусом ККГЛ [9]. Возможность вызывать у человека моноинфекцию вирусами комплекса JMTV была описана для вируса Alongshan в 2019 г. [8]. Авторам удалось описать 86 случаев нового лихорадочного заболевания человека после укусов таежного клеща на севере Китая, вызванного вирусом Alongshan. Моноинфекция вирусом JMTV также была описана в Китае [7].

Исследованные нами сыворотки крови пациентов были забраны в разгар проявления клинических симптомов заболевания ККГЛ. По всей вероятности, пациенты были инфицированы через укус клеща, что привело к развитию заболевания. Выявление одновременно двух вирусов в крови пациентов в разгар проявления клинических симптомов заболевания говорит о наличии вирусной микст-инфекции у этих пациентов. Полученные данные позволяют высказать предположение, что циркулирующие на юге России варианты JMTV вируса способны эффективно реплицироваться в организме человека совместно с вирусом ККГЛ. Это дополнительно подтверждает ранее высказанную гипотезу, что различные вирусы группы Jingmen tick virus, обнаруживаемые в клещах, способны адаптироваться к широкому кругу клещей-переносчиков и эффективно реплицироваться в теплокровных животных, включая приматов и человека, вызывая при этом новые инфекционные заболевания человека [4, 7].

Нуклеотидные последовательности изолятов JMTV кластеризовались вместе и формировали отдельную филогенетическую ветвь при сравнении с ранее известными последовательностями JMTV вируса. Уровень гомологии нуклеотидной последовательности обнаруженных новых вариантов JMTV на юге России составлял всего 81−82% с европейскими изолятами из Косово, которые были описаны в 2018 г. Это свидетельствует о широком распространении вируса JMTV в Европе и его значительном генетическом разнообразии в различных географических регионах. Определенные геномные нуклеотидные последовательности были депонированы в GenBank под названием Manych virus. Филогенетический анализ показывает, что выделенные изоляты Manych virus наиболее близки к африканским изолятам Kindia tick virus, что говорит о возможности заноса вирусов комплекса JMTV из Африки на территорию юга России.

Ограничения исследования

К сожалению, существующие данные по генетическому разнообразию и таксономии вирусов комплекса JMTV пока очень ограничены. Это не позволяет более детально провести оценку особенностей филогеографии этих вирусов. Но даже имеющиеся данные показывают фактически глобальное распространение Jingmen tick virus.

Заключение

Таким образом, в сыворотках крови четырех пациентов из Ростовской области с клиническим диагнозом ККГЛ выявлено одновременное наличие РНК вируса ККГЛ и РНК многокомпонентного вируса JMTV. Секвенирование фрагмента S-сегмента ККГЛ позволило генотипировать вирус ККГЛ как геновариант Европа 1.

Полученные результаты позволили заключить, что на юге России впервые у людей обнаружен многокомпонентный флавивирус JMTV. По всей вероятности, JMTV Manych virus совместно с вирусом ККГЛ способен вызывать вирусную инфекцию у человека с клиническими проявлениями, характерными для ККГЛ.

Дополнительная информация

Источник финансирования. Исследования поддержаны Российской федеральной службой по надзору в сфере защиты прав потребителей и благополучия человека (Государственные задания: № 141-00171-17-00, № 141-00022-19-01 и № 141-00069-18-01).

Конфликт интересов. Авторы данной статьи подтвердили отсутствие конфликта интересов, о котором необходимо сообщить.

Участие авторов. В.А. Терновой ― проведение экспериментов с генетическим материалом вирусов ККГЛ и Manych, анализ геномных последовательностей и подготовка статьи, А.В. Гладышева ― проведение экспериментов с генетическим материалом вируса Manych, А.О. Семенцова ― проведение экспериментов с генетическим материалом вируса ККГЛ, А.В. Зайковская ― проведение экспериментов с вирусом ККГЛ, А.С. Волынкина ― сбор образцов, проведение экспериментов с вирусом ККГЛ, анализ геномных последовательностей, Е.С. Котенев ― сбор образцов, проведение экспериментов с вирусом ККГЛ, А.П. Агафонов ― организационное сопровождение работ и написание статьи, В.Б. Локтев ― организационное сопровождение работ, обработка экспериментальных материалов и написание статьи. Все авторы внесли существенный вклад в проведение поисково-аналитической работы и подготовку статьи, прочли и одобрили финальную версию до публикации.

×

About the authors

Vladimir A. Ternovoi

State Research Center for Virology and Biotechnology “Vector” Rospotrebnadzor

Author for correspondence.
Email: tern@vector.nsc.ru
ORCID iD: 0000-0003-1275-171X
SPIN-code: 1328-5960
ResearcherId: A-6497-2014

Ph. D. in Biology

Russian Federation, Novosibirsk region, Koltsovo

Anastasia V. Gladysheva

State Research Center for Virology and Biotechnology “Vector” Rospotrebnadzor

Email: Nastya95.ru@list.ru
ORCID iD: 0000-0002-7396-3954
SPIN-code: 5214-3421

стажер-исследователь

Russian Federation, Novosibirsk region, Koltsovo

Alexandra O. Sementsova

State Research Center for Virology and Biotechnology “Vector” Rospotrebnadzor

Email: sementsova_ao@vector.nsc.ru
ORCID iD: 0000-0002-7188-5948
SPIN-code: 3387-9642

младший научный сотрудник

Russian Federation, Novosibirsk region, Koltsovo

Anna V. Zaykovskaya

State Research Center for Virology and Biotechnology “Vector” Rospotrebnadzor

Email: zaykovskaya_av@vector.nsc.ru
ORCID iD: 0000-0002-7188-5948
SPIN-code: 9339-6505

Ph. D. in Biology

Russian Federation, Novosibirsk region, Koltsovo

Anna S. Volynkina

Stavropol Anti-plague Institute

Email: volyn444@mail.ru
ORCID iD: 0000-0001-5554-5882
SPIN-code: 3387-4340

Ph. D. in Biology

Russian Federation, 13-15, Sovetskaya street, Stavropol, 355035

Egor S. Kotenev

Stavropol Anti-plague Institute

Email: egor_kotenev@mail.ru
ORCID iD: 0000-0002-8036-8926
SPIN-code: 1562-9580

Ph. D. in Biology

Russian Federation, 13-15, Sovetskaya street, Stavropol, 355035

Alexander P. Agafonov

State Research Center for Virology and Biotechnology “Vector” Rospotrebnadzor

Email: agafonov@vector.nsc.ru
ORCID iD: 0000-0003-2577-0434
SPIN-code: 2112-2920

Doct. of Biology

Russian Federation, Novosibirsk region, Koltsovo

Valeriy B. Loktev

State Research Center for Virology and Biotechnology “Vector” Rospotrebnadzor

Email: valeryloktev@gmail.com
ORCID iD: 0000-0002-0229-321X
SPIN-code: 3496-8857

Doct. of biology Professor

Russian Federation, Novosibirsk region, Koltsovo

References

  1. Qin X-C, Shi M, Tian J-H, Lin X-D, et al. A tick-borne segmented RNA virus contains genome segments derived from unsegmented viral ancestors. Proc Natl Acad Sci U S A. 2014;111(18):6744–6749. doi: 10.1073/pnas.1324194111.
  2. Maruyama SR, Castro-Jorge LA, Ribeiro JM, et al. Characterisation of divergent flavivirus NS3 and NS5 protein sequences detected in Rhipicephalus microplus ticks from Brazil. Mem Inst Oswaldo Cruz. 2014;109(1):38–50. doi: 10.1590/0074-0276130166.
  3. Villa EC, Maruyama SR, de Miranda-Santos IKF, et al. Complete coding genome sequence for Mogiana tick virus, a Jingmenvirus isolated from ticks in Brazil. Genome Announc. 2017;5(18):e00232-17. doi: 10.1128/genomeA.00232-17.
  4. Ladner JT, Wiley MR, Beitzel B, et al. A multicomponent animal virus isolated from mosquitoes. Cell Host Microbe. 2016;20(3):357–367. doi: 10.1016/j.chom.2016.07.011.
  5. Emmerich P, Jakupi X, von Possel R, et al. Viral metagenomics, genetic and evolutionary characteristics of Crimean-Congo hemorrhagic fever orthonairovirus in humans, Kosovo. Infect Genet Evol. 2018;65:6–11. doi: 10.1016/j.meegid.2018.07.010.
  6. Meng F, Ding M, Tan Z, et al. Virome analysis of tick-borne viruses in Heilongjiang Province, China. Ticks Tick Borne Dis. 2019;10(2):412−420. doi: 10.1016/j.ttbdis.2018.12.002.
  7. Na Jia, Hong-Bo Liu, Xue-Bing Ni, et al. Emergence of human infection with Jingmen tick virus in China: A retrospective study. EBio Medicine. 2019;43:317−324. doi: 10.1016/j.ebiom.2019.04.004.
  8. Wang ZD, Wang B, Wei F, et al. New segmented virus associated with human febrile illness in China. N Engl J Med. 2019;380(22):2116−2125. doi: 10.1056/NEJMoa1805068.
  9. Whitehouse CA. Crimean-Congo hemorrhagic fever. Antiviral Res. 2014;64(3):145–160. doi: 10.1016/j.antiviral.2004.08.001.
  10. Fajs L, Jakupi X, Ahmeti S, et al. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus in Kosovo. PLoS Negl Trop Dis. 2014;8(1):e2647.
  11. Fajs L, Humolli I, Saksida A, et al. Prevalence of Crimean-Congo hemorrhagic fever virus in healthy population, livestock and ticks in Kosovo. PLoS One. 2014;9(11):e110982. doi: 10.1371/journal.pone.0110982.
  12. Sherifi K, Cadar D, Muji S, et al. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2) in ticks in Kosovo, 2012. PLoS Negl Trop Dis. 2014;8(10):e3168. eCollection. doi: 10.1371/journal.pntd.0003168.
  13. Вакалова Е.В., Волынкина А.С., Котенев Е.С., и др. Детекция и генетическая характеристика РНК-изолятов вируса Крымской-Конго геморрагической лихорадки, выделенных из клещей Hyalomma marginatum в Астраханской области (2016 г.) // Эпидемиология и инфекционные болезни. — 2017. — Т.22. — №5. — С. 248−253. [Vakalova EV, Volynkina AS, Korenev ES, et al. Detecrion and genetic characteristics of RNA isolates of Crimean-Congo haemorrhagic fever virus from the hyalomma marginatum ticks collected in the Astrakhan region (2016). Epidemiology and infectious diseases. 2017;22(5):248−253. (In Russ).] doi: 10.1882/1560-9529-2017-22-5-248-253.
  14. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870−1874. doi: 10.1093/molbev/msw054.
  15. Morovvati A, Ghalyanchi-Langeroudi A, Soleimani M, et al. Emergence of a new genotype of crimean-congo hemorrhagic fever virus in Iran. Iranian J Virol. 2012;6(3):24−29.

Supplementary files

Supplementary Files
Action
1. Fig. 1. Phylogenetic analysis of the CCHF virus based on the S-segment (1450 nucleotides). The analysis was carried out by the Neighbor-joining method using a two-parameter Kimura model. The significance of the constructed tree was estimated using bootstrap analysis with 1000 repetitions.

Download (374KB)
2. Fig. 2. The phylogenetic tree of the JMTV group, built on the basis of known nucleotide sequences. The analysis was carried out by the Neighbor-joining method using a two-parameter Kimura model. Original names of strains deposited in GenBank are given. The Alongshan virus sequence (MH158416) was used as an external group. The significance of the constructed tree was estimated using bootstrap analysis with 1000 repetitions.

Download (146KB)

Statistics

Views

Abstract: 891

PDF (Russian): 13

Article Metrics

Metrics Loading ...

Dimensions

PlumX


Copyright (c) 2020 Russian academy of sciences



This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies