Role of galectins 1 and 3 in the recruitment of eosinophilic granulocytes into tumor tissue in gastric and colon cancers

Cover Page
  • Authors: Kolobovnikova Y.V.1, Urazova O.I.1,2, Vasilieva O.A.1, Romanova E.V.1, Komar A.A.3, Litvinova L.S.3, Poletika V.S.4, Chumakova S.P.4, Novitsky V.V.1,2
  • Affiliations:
    1. Siberian State Medical University
    2. Tomsk State University of Control Systems and Radioelectronics
    3. Baltic Federal University named after I. Kant
    4. Siberian State Medical University  
  • Issue: Vol 74, No 5 (2019)
  • Pages: 317-322
  • Section: ONCOLOGY: CURRENT ISSUES
  • URL: https://vestnikramn.spr-journal.ru/jour/article/view/1189
  • DOI: https://doi.org/10.15690/vramn1189
  • Cite item
Open Access Open Access
Restricted Access Access granted
Restricted Access Subscription or Fee Access

Abstract


Background: Gastric and colon tumors are often associated with eosinophilic infiltration of tumor tissue, the significance of which is still not entirely clear. The recruitment of eosinophils into the tissues can be in part regulated by galectins ― galactose-binding proteins which are expressed by a variety of tissues and are capable of exerting a broad range of effects.

Aims: To evaluate the expression of galectin-1 and galectin-3 in tumor tissue, and gal-3 gene mRNA expression in blood eosinophils in patients with gastric and colon cancer with or without tissue eosinophilia.

Materials and methods: The study included a total of 107 patients (84 males and 23 females, average age 60,9 ± 6,8) with verified gastric cancer (52 persons) and colon cancer (55 persons), who underwent treatment or were registered at the dispensary at the regional medical institution “Tomsk Regional Oncology Center” (Tomsk, Russia). The control group consisted of 15 men and 11 women of comparable age. The materials of the research included samples of gastric and colon tumors obtained during surgery, and eosinophilic granulocytes isolated from whole blood by immunomagnetic separation. Galectin-1 and galectin-3 expression in tumor tissue was evaluated by immunohistochemistry. The expression of gal-3 gene mRNA in eosinophils was determined by real-time reverse transcription polymerase chain reaction. Statistical analysis of the results was carried out using the non-parametric Mann-Whitney U test for independent samples with Benjamini-Hochberg procedure for multiple comparisons, and the Chi-square Pearson criterion with Yates correction.

 Results: In patients with gastric cancer and colon cancer, regardless of the presence of tissue eosinophilia, low expression of galectin-3 in the tumor tissue and high expression of gal-3 gene mRNA in peripheral blood eosinophils were found. Gastric and colon cancer patients with eosinophilic infiltration of tumor tissue were characterized by low expression of galectin-1 within tumor cells (in 64.0% cases, χ2 = 4.890, р = 0.029; and in 73.9% cases, χ2 = 5.981, p = 0.031 respectively). There was a statistically significant connection between the level of galectin-1 expression by tumor cells and the presence of tissue eosinophilia both in gastric (φ = 0.307) and colon cancer (φ = 0.330).

Conclusion: Low expression of galectin 1 and 3 by tumor cells in gastric and colon cancer with tissue eosinophilia indicates the lack of a significant effect of these proteins on the process of recruiting eosinophilic granulocytes into tumor tissue. Increased expression of galectin-3 in blood eosinophils in gastric and colon cancer is not associated with the presence of eosinophilic infiltration of tumor tissue.


Full Text

Обоснование

Механизмы рекрутирования эозинофилов в опухоль связывают главным образом с действием хемоаттрактантов ― эотаксинов 1, 2, 3, интерлейкина (interleukin, IL) 5, RANTES (regulated on activation normal t-cell expressed and secreted, и др.), секретируемых трансформированными клетками и элементами опухолевого микроокружения [1, 2]. Факторами регуляции миграции эозинофильных гранулоцитов в опухоль могут быть галектины ― бета-галактозидсвязывающие белки с про- и противоопухолевыми свойствами [3]. Среди галектинов адгезивные свойства проявляет галектин-3, высокая экспрессия которого усиливает миграцию эозинофильных гранулоцитов, опосредованную действием эотаксина-1 [4]. Способность к привлечению и активации эозинофилов установлена также у галектина-1: он усиливает экспрессию адгезивных структур и апоптоз этих клеток [5]. Вместе с тем имеются данные о негативной регуляции галектин-1-опосредованного хемотаксиса эозинофильных гранулоцитов [6].

Опухолевые заболевания характеризуются дисбалансом экспрессии галектинов 1 и 3, что может влиять не только на пролиферацию трансформированных клеток, но и на процесс рекрутирования эозинофилов в ткань новообразования [7].

Цель исследования ― оценить экспрессию галектина-1 и галектина-3 опухолевыми клетками и м-РНК гена галектина-3 в эозинофильных гранулоцитах крови при раке желудка и раке толстого кишечника с тканевой эозинофилией и без нее.

Методы

Дизайн исследования

Проведено наблюдательное одноцентровое одномоментное контролируемое нерандомизированное исследование случай-контроль.

Критерии соответствия

В исследование вошли пациенты с верифицированным диагнозом рака желудка (код С16 по МКБ-10) и рака толстого кишечника (код С18−С20 по МКБ-10).

Критерием включения в исследование считали наличие у пациентов злокачественных новообразований желудка и толстого кишечника.

Критериями исключения пациентов из исследования были предоперационная терапия, другие опухоли, обострение хронических заболеваний аллергической, аутоиммунной и инфекционной природы, отказ от участия в исследовании.

Условия проведения

Исследование выполнено в патологоанатомическом отделении ОГАУЗ «Томский областной онкологический диспансер» (далее ОГАУЗ «ТООД»), в лаборатории клинической и экспериментальной патофизиологии кафедры патофизиологии Сибирского государственного медицинского университета (Томск) и лаборатории иммунологии и клеточных биотехнологий инновационного парка Балтийского федерального университета им. И. Канта (Калининград). В исследование были включены пациенты, проживающие на территории г. Томска и Томской области. Контрольная группа была сформирована на базе клинико-диагностической лаборатории ОГАУЗ «ТООД» (Томск).

Продолжительность исследования

Набор пациентов с диагнозом рака желудка и рака толстого кишечника осуществлялся в период с августа 2018 по май 2019 г.

Описание медицинского вмешательства

Образцы тканей злокачественных опухолей желудка и толстого кишечника были получены в ходе оперативного вмешательства, проведенного пациентам со злокачественными новообразованиями желудка и толстого кишечника. Взятие периферической крови у пациентов и здоровых доноров производилось из локтевой вены утром натощак в объеме 9 мл в вакуумные пробирки с добавлением антикоагулянта K3-ЭДТА.

Исходы исследования

Конечной точной исследования была запланирована оценка взаимосвязи интенсивности экспрессии галектина-1 и галектина-3 в опухолевой ткани в зависимости от наличия инфильтрации опухоли эозинофильными гранулоцитами.

Анализ в подгруппах

В исследование вошли пациенты с диагнозом рака желудка и рака толстого кишечника. Пациенты были разделены на группы в зависимости от наличия или отсутствия эозинофильной инфильтрации ткани опухоли. Подсчет тканевых эозинофилов в образцах опухолевой ткани желудка и толстого кишечника проводили с использованием светового микроскопа Leica DM2000 (Leica Microsystems, Германия). В области опухолевого очага в «горячих точках» просматривали не менее 20 полей зрения. При обнаружении в одном поле зрения 10 и более эозинофильных гранулоцитов делали заключение о наличии эозинофильной инфильтрации опухолевой ткани [8]. При отсутствии или наличии единичных клеток в поле зрения судили об отсутствии тканевой эозинофилии.

В основную группу исследования вошли 25 больных раком желудка, в опухолевой ткани которых регистрировалась тканевая эозинофилия [8], в группу сравнения ― 27 больных раком желудка без эозинофилии. Среди пациентов с диагнозом рака толстого кишечника в основную группу исследования вошли 23 пациента с эозинофильной инфильтрацией опухолевой ткани, в группу сравнения ― 32 больных раком толстого кишечника без эозинофилии.

Контрольную группу составили здоровые доноры.

Методы регистрации исходов

Изучение экспрессии галектинов 1 и 3 клетками опухолевой ткани желудка и толстого кишечника осуществляли методом иммуногистохимии [9] на автоматическом иммуногистостейнере Bond-maX (Leica Biosystems, Германия) с применением поликлональных антител к галектину-1 (рабочее разведение 1:500, кроличьи; GeneTex, США) и галектину-3 (клон 9C4, RTU, мышиные; Cell Marque, США). Регистрацию экспрессии галектинов в ткани новообразования осуществляли полуколичественным способом в участках максимальной экспрессии маркера, учитывали цитоплазматическую и ядерную реакции окрашивания. Экспрессию галектина считали низкой при отсутствии окрашивания, выявлении окрашивания любой интенсивности (менее 25% опухолевых клеток) или слабого окрашивания (до 50% опухолевых клеток). Интенсивную положительную реакцию (более 25% клеток) и положительное окрашивание любой интенсивности более чем 50% опухолевых клеток расценивали как высокую экспрессию галектина [7].

Выделение эозинофильных гранулоцитов из цельной крови выполняли на градиенте плотности Ficoll-Paque (p = 1,077 g/mL) с применением набора реагентов Eosinophil isolation kit (Miltenyi Biotec GmbH, Германия) методом иммуномагнитной сепарации. В эозинофилах крови оценивали экспрессию м-РНК гена галектина-3 методом полимеразной цепной реакции в реальном времени с использованием обратной транскрипции. Выделение РНК из эозинофилов проводили сорбентно-колоночным методом (RNeasy Plus Mini Kit, QIAGEN, Германия). При участии обратной транскриптазы далее синтезировали ДНК на матрице м-РНК. Полученный фрагмент ДНК амплифицировали методом полимеразной цепной реакции в режиме реального времени с использованием SYBR Green I (Мolecular Probe, США) на амплификаторе CFX96 Touch (Bio-Rad, США). Использовали праймеры, позволяющие специфично амплифицировать фрагменты кДНК гена галектина-3 (LGALS3) ― F: TCCACTTTAACCCACGCTTC; R: CAAATGGGAAAACCGACTGT. Относительный уровень экспрессии мРНК гена галектина-3 рассчитывали по формуле Пфаффла:

targ + Eref)Ct(ref) - Ct(targ),

где E ― эффективность праймеров, Ct ― значение порогового цикла амплификации, targ ― целевой ген галектин-3, ref ― ген «домашнего хозяйства» β2-микроглобулин [10].

Этическая экспертиза

Исследование одобрено Локальным этическим комитетом ФГБОУ ВО «СибГМУ» Минздрава России (Протокол № 5669 от 27.11.2017). Все пациенты и здоровые добровольцы подписывали информированное согласие об участии в исследовании.

Статистический анализ

Размер выборки предварительно не рассчитывался. Статистический анализ результатов исследования проводили с помощью программы Statistica for Windows 10.0. Проверку соответствия выборочных данных закону нормального распределения осуществляли по критерию Шапиро−Уилка. Результаты представляли в виде медианы (Ме), первого (Q1) и третьего (Q3) квартилей. Для оценки статистической значимости различий между выборками применяли непараметрический U-критерий Манна−Уитни для независимых выборок с поправкой Бенджамини−Хохберга для множественного сравнения. Для расчета достоверности различий результатов иммуногистохимического метода между сравниваемыми группами анализировали таблицы сопряженности с применением критерия хи-квадрата Пирсона. В случае варьирования ожидаемой частоты в интервале от 5 до 9 критерий хи-квадрат рассчитывали с поправкой Йейтса. Для оценки силы взаимосвязи между переменными рассчитывали коэффициент ассоциации φ. Различия считали статистически значимыми при значении р < 0,05.

Результаты

Объекты (участники) исследования

В исследование вошли 107 пациентов с раком желудка (52 человека, из них 39 мужчин и 13 женщин) и раком толстого кишечника (55 человек, из них 45 мужчин и 10 женщин) в возрасте от 37 до 78 лет, проходившие лечение в ОГАУЗ «ТООД» (главный врач ― С.В. Мазеина). В группе больных раком желудка у 25 человек (средний возраст 66,1 ± 3,9 года) регистрировалась тканевая эозинофилия, у 27 пациентов (средний возраст 64,1 ± 4,9 года) эозинофилы в опухолевой ткани не встречались. Среди больных раком толстого кишечника опухолевый процесс ассоциировался с тканевой эозинофилией у 23 человек (средний возраст 62,9 ± 6,7 года), у 32 пациентов (средний возраст 63,1 ± 4,9 года) опухолеассоциированная тканевая эозинофилия не регистрировалась. В группу контроля были включены 26 здоровых доноров ― 15 мужчин и 11 женщин (средний возраст 61,1 ± 2,5 года).

У здоровых лиц и пациентов, включенных в исследование, количество эозинофильных гранулоцитов в периферической крови соответствовало норме. Относительное количество эозинофильных гранулоцитов в периферической крови в контрольной группе было равным 0,5% (0–1,5), у больных раком желудка ― 3,0% (1,5–5,0), р = 0,491; у больных раком толстого кишечника ― 2,0% (0,5–3,5), р = 0,392. Взятие биологического материала у пациентов проводилось до лечения.

Основные результаты исследования

В результате нашего исследования в образцах опухолевой ткани желудка и толстого кишечника злокачественно трансформированные клетки проявляли положительную реакцию на галектин-1 и галектин-3. Однако только у 24,0% пациентов с диагнозом рака желудка, сопровождавшегося тканевой эозинофилией, и 25,9% больных раком желудка без таковой обнаруживалась высокая экспрессия галекина-3 в опухолевой ткани. Сходные результаты были получены при локализации опухолевого процесса в толстом кишечнике (табл. 1). У больных раком желудка и раком толстого кишечника более чем в 70% случаев отмечался низкий уровень экспрессии галекина-3 в опухолевой ткани вне зависимости от наличия в ней тканевых эозинофилов (χ2 = 0,026, р = 0,051 и χ2 = 0,118, p = 0,064 соответственно).

 

Таблица 1. Экспрессия галектина-1 и галектина-3 опухолевыми клетками при раке желудка и толстого кишечника

Экспрессия галектинов

Локализация опухоли

Число больных, абс. (%)

Рак желудка (n = 52)

Рак толстой кишки (n = 55)

с ЭИ (n = 25)

без ЭИ (n = 27)

с ЭИ (n = 23)

без ЭИ (n = 32)

Отсутствовала или низкая экспрессия галектина-1

16 (64,0)

9 (33,3)

17 (73,9)

13 (40,6)

Высокая экспрессия галектина-1

9 (36,0)

18 (66,7)

6 (26,1)

19 (59,3)

 

χ2 = 4,890, р = 0,029; φ = 0,307

χ2 = 5,981, p = 0,031; φ = 0,330

Отсутствовала или низкая экспрессия галектина-3

19 (76,0)

20 (74,1)

19 (82,6)

24 (75,0)

Высокая экспрессия галектина-3

6 (24,0)

7 (25,9)

4 (17,4)

8 (25,0)

 

χ2 = 0,026, р = 0,051

χ2 = 0,118, p = 0,064

Примечание. р ― уровень статистической значимости различий между группами больных, χ2 ― критерий хи-квадрат Пирсона с поправкой Йейтса, φ ― критерий оценки силы взаимосвязи между номинальными переменными. ЭИ ― эозинофильная инфильтрация.

 

Анализ экспрессии галектина-1 в опухолевой ткани показал низкий ее уровень у большинства пациентов с раком желудка и толстого кишечника, ассоциированным с эозинофильной инфильтрацией опухоли (у 64,0 и 73,9% пациентов соответственно), тогда как среди больных, в опухолевой ткани которых эозинофильные гранулоциты отсутствовали, низкая экспрессия галектина-1 была зарегистрирована только у 33,3% пациентов с раком желудка и 40,6% больных раком толстого кишечника (см. табл. 1). Установлена ассоциация гипоэкспрессии галектина-1 опухолевыми клетками с наличием эозинофильных гранулоцитов в опухолевой ткани при раке желудка (φ = 0,307) и раке толстого кишечника (φ = 0,330). Отсутствие тканевой эозинофилии при раке желудка и раке толстого кишечника сочеталось, напротив, с высокой экспрессией в опухоли галектина-1 (см. табл. 1).

При исследовании экспрессии м-РНК гена галектина-3 в эозинофилах крови было показано статистически значимое повышение относительного ее уровня во всех группах пациентов с диагнозом рака желудка и рака толстого кишечника по сравнению с аналогичным параметром у здоровых доноров (табл. 2).

 

Таблица 2. Экспрессия мРНК гена галектина-3 в эозинофилах крови при раке желудка и раке толстого кишечника, Mе (Q1−Q3)

Уровень экспрессии, отн. ед.

Здоровые доноры

(n = 26)

Пациенты с раком желудка

Пациенты с раком толстого кишечника

с ЭИ (n = 25)

без ЭИ (n = 27)

с ЭИ (n = 23)

без ЭИ (n = 32)

LGALS3

0,015

(0,013−0,023)

0,186

(0,121−1,025) р = 0,003

0,929

(0,217−1,060) р = 0,005

1,373

(0,373−2,706) р = 0,045

0,482

(0,413−0,668) р = 0,002

Примечание. р ― уровень статистической значимости различий по сравнению с соответствующим параметром у здоровых доноров. ЭИ ― эозинофильная инфильтрация.

 

Следует отметить, что у больных раком толстого кишечника, сопровождающимся эозинофильной инфильтрацией опухоли, относительный уровень экспрессии м-РНК гена галектина-3 в эозинофилах крови оказался в 2,8 раза выше значения соответствующего показателя у пациентов с раком толстого кишечника без эозинофилии. В то же время у больных раком желудка, в опухолевой ткани которых присутствуют эозинофильные гранулоциты, относительный уровень экспрессии галектина-3 в эозинофилах крови, напротив, был почти в 5 раз ниже такового при раке желудка без тканевой эозинофилии. Выявленные нами различия экспрессии м-РНК гена галектина-3 в эозинофильных гранулоцитах крови при раке желудка и толстого кишечника, сопровождающегося тканевой эозинофилией и без нее, не достигали статистически значимого уровня (см. табл. 2).

Обсуждение

Резюме основного результата исследования

При раке желудка и раке толстого кишечника, ассоциированных с тканевой эозинофилией, установлена низкая экспрессия в опухолевой ткани галектина-1. Высокая экспрессия галектина-3 эозинофилами периферической крови и низкая экспрессия галектина-3 клетками опухоли при раке желудка и раке толстого кишечника не зависят от наличия эозинофильной инфильтрации опухоли.

Обсуждение основного результата исследования

Наиболее широко изучаемыми представителями семейства галектинов в аспекте опухолеассоциированной тканевой эозинофилии являются галектин-1 и галектин-3. Последний экспрессируется многими клетками, в том числе эозинофилами, эндотелиоцитами, эпителиоцитами, опухолевыми клетками и др. Галектин-3, экспрессируемый эозинофилами, обеспечивает адгезию клеток при взаимодействии с VCAM-1 и самим галектином-3 эндотелиоцитов. Эндотелиальный галектин-3, в свою очередь, взаимодействует с α4β1-интегринами на поверхности эозинофилов и функционирует также в качестве адгезивной структуры [4]. Рекрутирование эозинофильных гранулоцитов опосредовано не только мембранным, но и внутриклеточно расположенным галектином-3. По данным литературы, при делеции гена галектина-3 в эозинофилах у мышей с бронхиальной астмой отмечались значительное снижение эозинофильной инфильтрации, подавление Th2-зависимого иммунного ответа и ремоделирования бронхов [11].

В результате оценки уровня экспрессии м-РНК гена галектина-3 в эозинофильных гранулоцитах крови у больных раком желудка и раком толстого кишечника выявлено превышение значений нормы во всех группах независимо от эозинофильной инфильтрации опухолевой ткани. Отсутствие зависимости между экспрессией галектина-3 эозинофилами крови и опухолеассоциированной тканевой эозинофилией при раке желудка и раке толстого кишечника, по-видимому, обусловлено способностью галектина-3 обеспечивать лишь начальное прикрепление и роллинг эозинофилов внутрисосудистого пула, тогда как прочная адгезия и миграция эозинофильных гранулоцитов через сосудистый эндотелий опосредованы кооперацией других молекул.

По данным литературы, галектин-3 выявляется и в клетках самой опухоли, его экспрессию связывают с инвазией опухолевых клеток и метастазированием [12]. При исследовании экспрессии галектина-3 в опухолевой ткани у больных раком желудка и раком толстого кишечника нами было установлено снижение ее уровня в большинстве случаев вне зависимости от присутствия эозинофильных гранулоцитов в ткани новообразований. Полученные результаты, скорее, подтверждают предыдущий тезис об активирующем влиянии галектина-3 на эозинофилы периферической крови. Кроме этого, реализация адгезивных свойств галектина-3 в опухолевой ткани может зависеть от регулирующего влияния ключевых факторов хемотаксиса эозинофильных лейкоцитов.

Еще одним регулятором хемокинзависимой миграции эозинофилов является внеклеточный галектин-1. По сведениям S. Rao и соавт., эозинофильные гранулоциты мышей с делецией гена галектина-1 проявляли слабую способность к миграции в очаг воспаления [6]. В то же время X. Ge и соавт. представили противоположные результаты своих исследований: при делеции гена галектина-1 у мышей с бронхиальной астмой отмечалось повышенное рекрутирование эозинофилов и CD3+ Т-лимфоцитов в ткань дыхательных путей, а также увеличение числа эозинофилов в периферической крови и костном мозге [5]. Авторами был также продемонстрирован дозозависимый эффект влияния внеклеточного галектина-1: при низкой концентрации галектин-1 индуцировал адгезию эозинофилов к VCAM-1, инициировал перераспределение интегрина CD49d в мембране эозинофилов и не оказывал значимого влияния на эотаксин-1-зависимый механизм миграции эозинофилов в ткани. В высокой же концентрации галектин-1, напротив, угнетал экспрессию CD49d и рецептора к эотаксину-1 на эозинофилах, а также индуцировал апоптоз эозинофильных гранулоцитов [13].

Согласно результатам иммуногистохимического исследования, при раке желудка и раке толстого кишечника с тканевой эозинофилией превалировала низкая экспрессия галектина-1 в опухолевой ткани. Показана достоверная взаимосвязь между низкой экспрессией в опухоли галектина-1 и наличием эозинофильных гранулоцитов в ткани злокачественных новообразований желудка и толстого кишечника. Отсутствие эозинофильной инфильтрации в опухолевой ткани желудка и толстого кишечника сочеталось, напротив, с гиперэкспрессией опухолевыми клетками галектина-1, способного ограничивать рекрутирование эозинофильных гранулоцитов в ткани.

Ограничения исследования

Проведенное исследование ограничено изучением в эозинофильных гранулоцитах крови только галектина-3, экспрессию галектина-1 не оценивали. Последнее обусловлено отсутствием в современной литературе сведений относительно экспрессии данного лектина эозинофилами человека. Еще одним ограничением настоящего исследования является небольшой объем выборок, при увеличении которого показатель экспрессии галектина-3 в опухолевой ткани может статистически значимо отличаться между группами больных раком желудка (χ2 = 0,026, р = 0,051) и раком толстого кишечника (χ2 = 0,118, p = 0,064) с тканевой эозинофилией и без нее.

Заключение

В результате исследования установлен дефицит экспрессии галектина-1 и галектина-3 в опухолевой ткани при злокачественных новообразованиях желудка и толстого кишечника, сопровождающихся тканевой эозинофилией, что свидетельствует об отсутствии значимого влияния данных белков на процесс рекрутирования эозинофилов в опухолевую ткань. Между тем галектины, по нашему мнению и данным литературы, могут выступать в роли факторов дисрегуляции миграции эозинофильных гранулоцитов в ткани. Так, гиперэкспрессия опухолевыми клетками галектина-1 при раке желудка и раке толстого кишечника без эозинофилии может служить элементом механизма «ускользания» опухолевых клеток от агрессивного цитотоксического влияния эозинофильных гранулоцитов. С другой стороны, высокий уровень экспрессии м-РНК галектина-3 эозинофильными гранулоцитами крови у больных раком желудка и раком толстого кишечника не только с отсутствием, но и наличием эозинофильной инфильтрации опухолевой ткани может свидетельствовать о регуляции посредством указанного белка начального этапа адгезии эозинофилов к сосудистому эндотелию. Многообразие функций галектинов и наличие дозозависимого эффекта их действия обосновывает необходимость дальнейшего исследования значения лектинов в механизмах формирования тканевой эозинофилии и опухолевой прогрессии при онкологических заболеваниях.

Дополнительная информация

Источник финансирования. Исследование выполнено при финансовой поддержке Совета по грантам Президента Российской Федерации для государственной поддержки молодых российских ученых (МД-2788.2019.7) и ведущих научных школ (НШ-2690.2018.7) и Российского фонда фундаментальных исследований (договор № 18-015-00160/19).

Конфликт интересов. Авторы данной статьи подтвердили отсутствие конфликта интересов, о котором необходимо сообщить.

Участие авторов: все авторы внесли значимый вклад в проведение исследования и подготовку статьи, прочли и одобрили финальную версию до публикации.

Выражение признательности. Коллектив авторов выражает благодарность заведующему клинико-диагностической лабораторией ОГАУЗ «ТООД», д-ру мед. наук А.И. Дмитриевой и врачу клинико-диагностической лаборатории ОГАУЗ «ТООД», канд. мед. наук К.И. Янкович за помощь в наборе клинического материала и подготовке материала к исследованию.

About the authors

Yulia V. Kolobovnikova

Siberian State Medical University

Author for correspondence.
Email: kolobovnikova.julia@mail.ru
ORCID iD: 0000-0001-7156-2471
SPIN-code: 3638-1577
ResearcherId: N-8714-2016

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050

MD, PhD

Olga I. Urazova

Siberian State Medical University; Tomsk State University of Control Systems and Radioelectronics

Email: urazova72@yandex.ru
ORCID iD: 0000-0002-9457-8879
SPIN-code: 9696-4110

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050; 40, Lenin Avenue, Tomsk, 634050

MD, PhD, Professor

Olga A. Vasilieva

Siberian State Medical University

Email: vasiljeva-24@yandex.ru
ORCID iD: 0000-0002-2882-4533
SPIN-code: 9665-5714

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050

MD, PhD

Elena V. Romanova

Siberian State Medical University

Email: dissovet.ssmu@gmail.com
ORCID iD: 0000-0002-8769-5743
SPIN-code: 4339-2382

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050

Senior Lecturer of the Microbiology and Virology Division

Alexanra A. Komar

Baltic Federal University named after I. Kant

Email: alexandkomar@gmail.com
ORCID iD: 0000-0002-1922-3592
SPIN-code: 5353-4230

Russian Federation, ul. Nevskogo, 14, Kaliningrad, 236041

Post-graduate Student of the Department of Fundamental Medicine

Larisa S. Litvinova

Baltic Federal University named after I. Kant

Email: larisalitvinova@yandex.ru
ORCID iD: 0000-0001-5231-6910
SPIN-code: 6703-3412

Russian Federation, ul. Nevskogo, 14, Kaliningrad, 236041

MD, PhD, Professor

Vadim S. Poletika

Siberian State Medical University
 

Email: vpoletika@yandex.ru
ORCID iD: 0000-0002-2005-305X
SPIN-code: 9153-0459

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050

Post-graduate Student of the Pathophysiology Division

Svetlana P. Chumakova

Siberian State Medical University
 

Email: chumakova_s@mail.ru
ORCID iD: 0000-0003-3468-6154
SPIN-code: 7536-2834

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050

MD, PhD, Professor

Vyacheslav V. Novitsky

Siberian State Medical University; Tomsk State University of Control Systems and Radioelectronics

Email: kaf.pat.fiziolog@ssmu.ru
ORCID iD: 0000-0002-9577-8370
SPIN-code: 7160-6881

Russian Federation, 2, Moscowski Trakt, Tomsk, 634050; 40, Lenin Avenue, Tomsk, 634050

MD, PhD, Professor

References

  1. Jain M, Kasetty S, Sudheendra US, et al. Assessment of tissue eosinophilia as a prognosticator in oral epithelial dysplasia and oral squamous cell carcinoma — an image analysis study. Patholog Res Int. 2014;2014:507512. doi: 10.1155/2014/507512.
  2. Wang T, Wei Y, Tian L, et al. C-C motif chemokine ligand 5 (CCL5) levels in gastric cancer patient sera predict occult peritoneal metastasis and a poorer prognosis. Int J Surg. 2016;32:136−142. doi: 10.1016/j.ijsu.2016.07.008.
  3. Rao SP, Wang Z, Zuberi RI, et al. Galectin-3 functions as an adhesion molecule to support eosinophil rolling and adhesion under conditions of flow. J Immunol. 2007;179(11):7800−7807. doi: 10.4049/jimmunol.179.11.7800.
  4. Ge XN, Ha SG, Liu FT, et al. Eosinophil-expressed galectin-3 regulates cell trafficking and migration. Front Pharmacol. 2013;4:37. doi: 10.3389/fphar.2013.00037.
  5. Ge XN, Ha SG, Greenberg YG, et al. Regulation of eosinophilia and allergic airway inflammation by the glycan-binding protein galectin-1. Proc Natl Acad Sci U S A. 2016;113(33):E4837−4846. doi: 10.1073/pnas.1601958113.
  6. Rao SP, Ge XN, Sriramarao P. Regulation of eosinophil recruitment and activation by galectins in allergic asthma. Front Med (Lausanne). 2017;4:68. doi: 10.3389/fmed.2017.00068.
  7. He XJ, Tao HQ, Hu ZM, et al. Expression of galectin-1 in carcinoma-associated fibroblasts promotes gastric cancer cell invasion through upregulation of integrin β1. Cancer Sci. 2014;105(11):1402−1410. doi: 10.1111/cas.12539.
  8. Pehlivanoglu B, Doganavsargil B, Sezak M, et al. Gastrointestinal parasitosis: histopathological insights to rare but intriguing lesions of the gastrointestinal tract. Turk Patoloji Derg. 2016;32(2):82−90. doi: 10.5146/tjpath.2015.01350.
  9. Руководство по иммуногистохимической диагностике опухолей человека / Под ред. С.В. Петрова, Н.Т. Райхлина. 3-е изд., доп. и перераб. ― Казань: Титул; 2004. ― 451 с. [Manual on immunohistochemical diagnostics of human tumours. Ed by SV Petrov, NT Rajhlin. 3rd revised and updated. Kazan’: Titul; 2004. 451 р. (In Russ).]
  10. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45. doi: 10.1093/nar/29.9.e45.
  11. Ge XN, Bahaie NS, Kang BN, et al. Allergen-induced airway remodeling is impaired in galectin-3-deficient mice. J Immunol. 2010;185(2):1205−1214. doi: 10.4049/jimmunol.1000039.
  12. Kim J, Moon C, Ahn M, et al. Immunohistochemical localization of galectin-3 in the pig retina during postnatal development. Mol Vis. 2009;15:1971−1976.
  13. Delbrouck C, Doyen I, Belot N, et al. Galectin-1 is overexpressed in nasal polyps under budesonide and inhibits eosinophil migration. Lab Invest. 2002;82(2):147−158. doi: 10.1038/labinvest.3780407.

Supplementary files

There are no supplementary files to display.

Statistics

Views

Abstract - 184

PDF (Russian) - 4

Cited-By


PlumX

Dimensions



Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies